ID: 922474555_922474565

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 922474555 922474565
Species Human (GRCh38) Human (GRCh38)
Location 1:225898324-225898346 1:225898365-225898387
Sequence CCGAGGTCGCAGATTGTTAACGA GGGGAGGAGCAATCCTAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31} {0: 1, 1: 0, 2: 1, 3: 16, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!