ID: 922581832_922581835

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 922581832 922581835
Species Human (GRCh38) Human (GRCh38)
Location 1:226703786-226703808 1:226703803-226703825
Sequence CCAGCTTCCGGCTTGGGAGAAAG AGAAAGGATGTGTTTCAGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!