ID: 922581832_922581838

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922581832 922581838
Species Human (GRCh38) Human (GRCh38)
Location 1:226703786-226703808 1:226703825-226703847
Sequence CCAGCTTCCGGCTTGGGAGAAAG GGTTTCCTCATTTGCAAAATGGG
Strand - +
Off-target summary No data {0: 3, 1: 62, 2: 602, 3: 3090, 4: 8917}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!