ID: 922581832_922581838 |
View in Genome Browser |
Spacer: 16 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 922581832 | 922581838 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 1:226703786-226703808 | 1:226703825-226703847 |
Sequence | CCAGCTTCCGGCTTGGGAGAAAG | GGTTTCCTCATTTGCAAAATGGG |
Strand | - | + |
Off-target summary | No data | {0: 3, 1: 62, 2: 602, 3: 3090, 4: 8917} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |