ID: 922748322_922748343

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 922748322 922748343
Species Human (GRCh38) Human (GRCh38)
Location 1:228059562-228059584 1:228059613-228059635
Sequence CCTCCCTGGGGGCGGGACTCCTC AGAACTCCTACCTGAAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 165} {0: 1, 1: 0, 2: 0, 3: 18, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!