ID: 922753790_922753805

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922753790 922753805
Species Human (GRCh38) Human (GRCh38)
Location 1:228083044-228083066 1:228083083-228083105
Sequence CCTGCCCCCGCCCGTCGCCCGGA GGGCTCTTCTCCAGGAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 426} {0: 1, 1: 0, 2: 4, 3: 25, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!