ID: 922798302_922798304

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 922798302 922798304
Species Human (GRCh38) Human (GRCh38)
Location 1:228352361-228352383 1:228352385-228352407
Sequence CCAAAGCTAGGTGCTGTGGCTCA GTCAGTAATCTCAACAATTTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 78, 3: 986, 4: 3740} {0: 1, 1: 3, 2: 180, 3: 4208, 4: 53639}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!