ID: 922834902_922834914

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 922834902 922834914
Species Human (GRCh38) Human (GRCh38)
Location 1:228620519-228620541 1:228620549-228620571
Sequence CCCCGAGATTTGCAGAGCGCGCC TTGGCGGGAGCCGTGGCACCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!