ID: 922834918_922834923

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 922834918 922834923
Species Human (GRCh38) Human (GRCh38)
Location 1:228620559-228620581 1:228620574-228620596
Sequence CCGTGGCACCGGGCGGGCCCGGA GGCCCGGAGGCCTGGGTCTCTGG
Strand - +
Off-target summary {0: 18, 1: 0, 2: 1, 3: 11, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!