ID: 922841132_922841140

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 922841132 922841140
Species Human (GRCh38) Human (GRCh38)
Location 1:228645387-228645409 1:228645409-228645431
Sequence CCGATGGGTGAATTGAATCGCCT TGGGCGTTCCGGGAGCGGGAAGG
Strand - +
Off-target summary No data {0: 18, 1: 0, 2: 0, 3: 6, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!