ID: 922864985_922864995

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 922864985 922864995
Species Human (GRCh38) Human (GRCh38)
Location 1:228852227-228852249 1:228852270-228852292
Sequence CCAGGTGGGAAGGGCTCCCTGGC GCACTGGTAGGAGTGCACGCTGG
Strand - +
Off-target summary {0: 14, 1: 16, 2: 28, 3: 92, 4: 338} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!