ID: 922928118_922928129

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 922928118 922928129
Species Human (GRCh38) Human (GRCh38)
Location 1:229367619-229367641 1:229367663-229367685
Sequence CCACCCGCCTCGGCCTCCCAAAA CCACTGTGCCCTGACAAATGAGG
Strand - +
Off-target summary {0: 1290, 1: 45467, 2: 132962, 3: 201493, 4: 160826} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!