ID: 922928127_922928129

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 922928127 922928129
Species Human (GRCh38) Human (GRCh38)
Location 1:229367636-229367658 1:229367663-229367685
Sequence CCAAAATGCTGGGATTACAGGCG CCACTGTGCCCTGACAAATGAGG
Strand - +
Off-target summary {0: 4469, 1: 137853, 2: 283836, 3: 246810, 4: 275164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!