ID: 922984306_922984309

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 922984306 922984309
Species Human (GRCh38) Human (GRCh38)
Location 1:229854045-229854067 1:229854064-229854086
Sequence CCCTCACGCTGACTTCTCACACT CACTCCCACTGCAGTTGTCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!