ID: 923055881_923055887

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 923055881 923055887
Species Human (GRCh38) Human (GRCh38)
Location 1:230425889-230425911 1:230425908-230425930
Sequence CCGGCGCCCTCCTCCGCGCGCCC GCCCCCGCCGCCCTCGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 88, 4: 812} {0: 1, 1: 1, 2: 4, 3: 43, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!