ID: 923366803_923366804

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 923366803 923366804
Species Human (GRCh38) Human (GRCh38)
Location 1:233269612-233269634 1:233269632-233269654
Sequence CCATCAATGTGGTTAAAGTAAAT AATTGAGTTTTCCTGCTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 240} {0: 1, 1: 0, 2: 2, 3: 20, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!