ID: 923369335_923369344

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 923369335 923369344
Species Human (GRCh38) Human (GRCh38)
Location 1:233295239-233295261 1:233295288-233295310
Sequence CCGTGAGGCTGATGGCACGTCTG TACCCACAGCTCCCCGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 100} {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!