ID: 923369338_923369344

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 923369338 923369344
Species Human (GRCh38) Human (GRCh38)
Location 1:233295274-233295296 1:233295288-233295310
Sequence CCTTCTTCCCTCCATACCCACAG TACCCACAGCTCCCCGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 86, 4: 576} {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!