ID: 923369339_923369360

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 923369339 923369360
Species Human (GRCh38) Human (GRCh38)
Location 1:233295281-233295303 1:233295320-233295342
Sequence CCCTCCATACCCACAGCTCCCCG ACTCACCAGGTGCAGGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 272} {0: 1, 1: 0, 2: 3, 3: 33, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!