ID: 923369346_923369351

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 923369346 923369351
Species Human (GRCh38) Human (GRCh38)
Location 1:233295291-233295313 1:233295307-233295329
Sequence CCACAGCTCCCCGGGACCGGACC CCGGACCCTCCCCACTCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175} {0: 1, 1: 0, 2: 2, 3: 31, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!