ID: 923369348_923369354

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 923369348 923369354
Species Human (GRCh38) Human (GRCh38)
Location 1:233295300-233295322 1:233295313-233295335
Sequence CCCGGGACCGGACCCTCCCCACT CCTCCCCACTCACCAGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 201} {0: 1, 1: 1, 2: 3, 3: 28, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!