ID: 923369348_923369355

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 923369348 923369355
Species Human (GRCh38) Human (GRCh38)
Location 1:233295300-233295322 1:233295314-233295336
Sequence CCCGGGACCGGACCCTCCCCACT CTCCCCACTCACCAGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 201} {0: 1, 1: 0, 2: 4, 3: 21, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!