ID: 923412719_923412727

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 923412719 923412727
Species Human (GRCh38) Human (GRCh38)
Location 1:233725822-233725844 1:233725854-233725876
Sequence CCCAAGGCCTTTTACCAGTTTGC GAGAAGCCAAAGGCCCGTTTGGG
Strand - +
Off-target summary {0: 13, 1: 24, 2: 27, 3: 29, 4: 174} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!