ID: 923412723_923412727

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 923412723 923412727
Species Human (GRCh38) Human (GRCh38)
Location 1:233725829-233725851 1:233725854-233725876
Sequence CCTTTTACCAGTTTGCACAGGGA GAGAAGCCAAAGGCCCGTTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!