ID: 923868388_923868396

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 923868388 923868396
Species Human (GRCh38) Human (GRCh38)
Location 1:237964317-237964339 1:237964369-237964391
Sequence CCCGACATCCCCGATGGCTGGCA TTCAGGAAAGCAGAAGTTACAGG
Strand - +
Off-target summary No data {0: 41, 1: 56, 2: 88, 3: 129, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!