|
Left Crispr |
Right Crispr |
| Crispr ID |
923915614 |
923915617 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:238500343-238500365
|
1:238500383-238500405
|
| Sequence |
CCAGTCACGTGGAACTGTGAGTC |
TTTATAAACTACACAGTCTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|