ID: 923967270_923967273

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 923967270 923967273
Species Human (GRCh38) Human (GRCh38)
Location 1:239155890-239155912 1:239155916-239155938
Sequence CCCTGACTGCCAGGAGAGAGTGC AGACACCAGTTGCAAGTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 11, 3: 48, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!