ID: 924052249_924052252

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 924052249 924052252
Species Human (GRCh38) Human (GRCh38)
Location 1:240091493-240091515 1:240091532-240091554
Sequence CCATGCAGAGGCAGACAGGGGGT ACCCGATGGCACCTCTAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 273} {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!