ID: 924418260_924418263

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 924418260 924418263
Species Human (GRCh38) Human (GRCh38)
Location 1:243882563-243882585 1:243882581-243882603
Sequence CCCTGCTGACACTGTACATACGG TACGGCTCACACCCAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 21, 3: 45, 4: 115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!