ID: 924458672_924458679

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 924458672 924458679
Species Human (GRCh38) Human (GRCh38)
Location 1:244238822-244238844 1:244238872-244238894
Sequence CCTTCTTCCATTAGTGAAGAAAG GCCTATAATCCCAGCACTTTGGG
Strand - +
Off-target summary No data {0: 20277, 1: 245443, 2: 271371, 3: 174555, 4: 143969}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!