ID: 924458672_924458681

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 924458672 924458681
Species Human (GRCh38) Human (GRCh38)
Location 1:244238822-244238844 1:244238875-244238897
Sequence CCTTCTTCCATTAGTGAAGAAAG TATAATCCCAGCACTTTGGGAGG
Strand - +
Off-target summary No data {0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!