|
Left Crispr |
Right Crispr |
Crispr ID |
924458672 |
924458681 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:244238822-244238844
|
1:244238875-244238897
|
Sequence |
CCTTCTTCCATTAGTGAAGAAAG |
TATAATCCCAGCACTTTGGGAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|