ID: 924511685_924511688

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 924511685 924511688
Species Human (GRCh38) Human (GRCh38)
Location 1:244733077-244733099 1:244733107-244733129
Sequence CCAGTAAGTTCTCAGGAGCTGGG GCTCAAGTATGTGCACTAAGAGG
Strand - +
Off-target summary No data {0: 7, 1: 57, 2: 141, 3: 215, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!