ID: 924516322_924516334

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 924516322 924516334
Species Human (GRCh38) Human (GRCh38)
Location 1:244769014-244769036 1:244769067-244769089
Sequence CCAGTCACTGCGCTCTCCCTCCC ACGGCCACTGTTAGGAGATTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!