ID: 924616721_924616728

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 924616721 924616728
Species Human (GRCh38) Human (GRCh38)
Location 1:245618033-245618055 1:245618055-245618077
Sequence CCTCCCACCAAAGTCAGGGTTAC CAGAAGGAAGAGAAGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91} {0: 1, 1: 1, 2: 23, 3: 442, 4: 3704}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!