ID: 924616725_924616728

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 924616725 924616728
Species Human (GRCh38) Human (GRCh38)
Location 1:245618040-245618062 1:245618055-245618077
Sequence CCAAAGTCAGGGTTACAGAAGGA CAGAAGGAAGAGAAGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 204} {0: 1, 1: 1, 2: 23, 3: 442, 4: 3704}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!