ID: 924657945_924657950

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 924657945 924657950
Species Human (GRCh38) Human (GRCh38)
Location 1:245990438-245990460 1:245990486-245990508
Sequence CCTACTTCCTTTTGGTCACACAG TGGATCTGACATGGTTTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 220} {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!