ID: 924669770_924669775

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 924669770 924669775
Species Human (GRCh38) Human (GRCh38)
Location 1:246111777-246111799 1:246111800-246111822
Sequence CCAGACTACTTCACCATGTGAGG TAAACGGTAGAGGCAGCAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84} {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!