ID: 924832547_924832551

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 924832547 924832551
Species Human (GRCh38) Human (GRCh38)
Location 1:247613540-247613562 1:247613593-247613615
Sequence CCTGGGAAAGGAGAATGAGGAGT CAGAGCAAACACATTTCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 383} {0: 1, 1: 0, 2: 3, 3: 23, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!