ID: 924957687_924957694

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 924957687 924957694
Species Human (GRCh38) Human (GRCh38)
Location 1:248945017-248945039 1:248945054-248945076
Sequence CCTGCGCCGGCGCGCCGCCTTTG CGTTCTCTTTAGCACACACCCGG
Strand - +
Off-target summary {0: 5, 1: 5, 2: 3, 3: 11, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!