ID: 924974629_924974642

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 924974629 924974642
Species Human (GRCh38) Human (GRCh38)
Location 2:161413-161435 2:161457-161479
Sequence CCATGGCTATGTGTGGGGACCCT GGCCGGGATGGTGGTTCCACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!