ID: 925080612_925080618

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 925080612 925080618
Species Human (GRCh38) Human (GRCh38)
Location 2:1061239-1061261 2:1061274-1061296
Sequence CCGTGTGATCCTGGGTTGGACGC AATGATGATAAACATTTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 88} {0: 1, 1: 0, 2: 5, 3: 74, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!