ID: 925163181_925163188

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 925163181 925163188
Species Human (GRCh38) Human (GRCh38)
Location 2:1701122-1701144 2:1701172-1701194
Sequence CCCAAAGCCAGGCCATGTGGTTT CGCTTCAGTGCTTCCTACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215} {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!