ID: 925163184_925163188

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 925163184 925163188
Species Human (GRCh38) Human (GRCh38)
Location 2:1701134-1701156 2:1701172-1701194
Sequence CCATGTGGTTTTCCATTAACATT CGCTTCAGTGCTTCCTACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 346} {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!