ID: 925170484_925170494

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 925170484 925170494
Species Human (GRCh38) Human (GRCh38)
Location 2:1747305-1747327 2:1747357-1747379
Sequence CCATCGCCCCTGCGGGATCCTGC TCCGGGTGCCATCGCCCCTGCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 14, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!