ID: 925170486_925170494

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 925170486 925170494
Species Human (GRCh38) Human (GRCh38)
Location 2:1747312-1747334 2:1747357-1747379
Sequence CCCTGCGGGATCCTGCGCACACT TCCGGGTGCCATCGCCCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 57} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!