ID: 925217529_925217534

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 925217529 925217534
Species Human (GRCh38) Human (GRCh38)
Location 2:2110417-2110439 2:2110457-2110479
Sequence CCAACCCATGTTAGCTTCTGTTT CCTCCAAGTTTCCCAAAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 453} {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!