ID: 925238231_925238249

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 925238231 925238249
Species Human (GRCh38) Human (GRCh38)
Location 2:2297730-2297752 2:2297771-2297793
Sequence CCCTCCTCCTTCTGCCCTCCCAG AAAATAAAGGGAATGTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 142, 4: 1483} {0: 1, 1: 0, 2: 4, 3: 49, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!