ID: 925386176_925386184

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 925386176 925386184
Species Human (GRCh38) Human (GRCh38)
Location 2:3463389-3463411 2:3463423-3463445
Sequence CCGGCGGGTGCAGGGGCCCCCGA TGCCGCGCCTGCCCCCGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133} {0: 1, 1: 0, 2: 1, 3: 23, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!