ID: 925614334_925614342

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 925614334 925614342
Species Human (GRCh38) Human (GRCh38)
Location 2:5731250-5731272 2:5731268-5731290
Sequence CCTGTTTCCTCCTCCCCTAGGAG AGGAGGTGTAAGTCTGAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!