ID: 925614341_925614343

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 925614341 925614343
Species Human (GRCh38) Human (GRCh38)
Location 2:5731265-5731287 2:5731279-5731301
Sequence CCTAGGAGGTGTAAGTCTGAGGA GTCTGAGGAAGGATGTACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!