ID: 925614341_925614349

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 925614341 925614349
Species Human (GRCh38) Human (GRCh38)
Location 2:5731265-5731287 2:5731315-5731337
Sequence CCTAGGAGGTGTAAGTCTGAGGA AGCTGTGGTGACCAGGGACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 37, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!